Explore a store in your browser
The RefgetStore Explorer is a web app for browsing a store's sequences, collections, aliases, and FHR metadata. It runs entirely in the browser, reading a store's static files directly over HTTP.
The refget store explore command points that Explorer at a store on your own machine:
it serves both the store's files and the Explorer web UI from a single local web server,
then opens your browser to it. This tutorial builds a small store from scratch and opens
it in the Explorer. It takes a couple of minutes and needs no internet connection.
Before you start
Section titled “Before you start”Install refget with the store extra, which provides the refget store commands:
pip install 'refget[store]'1. Create a FASTA file
Section titled “1. Create a FASTA file”The Explorer browses a store, and a store is built from sequences. Create a tiny FASTA file to work with:
cat > demo.fa <<'FASTA'>chr1 demo sequence oneACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTGGGGCCCCAAAATTTTACGTACGTACGTACGTACGTACGT>chr2 demo sequence twoTTTTAAAACCCCGGGGTTTTAAAACCCCGGGGTTTTAAAAFASTAAlready have a genome FASTA on hand? Use that instead — any .fa or .fa.gz file works.
2. Build a store
Section titled “2. Build a store”Initialize an empty store, then import the FASTA into it:
refget store init -p demo_storerefget store add demo.fa -p demo_storerefget store add digests each sequence and records a
sequence collection for the file. Check what landed
in the store:
refget store stats -p demo_store{ "storage_mode": "Encoded", "n_collections": "1", "n_sequences": "2"}3. Open the Explorer
Section titled “3. Open the Explorer”Point the Explorer at your new store:
refget store explore demo_storeThis starts a local server on http://127.0.0.1:8080 and opens your browser to the
Explorer, already loaded with demo_store. You'll land on the store overview, where you
can browse the collection from step 2, drill into its sequences, and inspect names,
lengths, and digests. Press Ctrl-C in the terminal to stop the server when you're done.
That's the whole loop: a FASTA on disk, a store, and a browsable view of it — no server to deploy and no data leaving your machine.
When to use it
Section titled “When to use it”Because the Explorer only needs static files, it works against a store anywhere — an S3
bucket, an HTTP server, or a directory on disk. The hosted Explorer at
refget.databio.org already covers stores
reachable from the public internet. refget store explore covers the cases it can't:
- A store on local disk. Browsers can't
fetch()file://URLs, so a store in a local directory needs a local web server to browse it. - A read-only mount, such as a CVMFS distribution of a reference store on a shared cluster.
- An air-gapped or offline machine, where the hosted Explorer is unreachable. The command bundles the Explorer web UI, so it works with no internet access.
Options
Section titled “Options”| Option | Description |
|---|---|
PATH | Store directory to explore (falls back to your configured store path). |
--host | Interface to bind (default 127.0.0.1). |
--port, -P | Port to serve on (default 8080; auto-increments if busy). |
--no-browser | Print the URLs instead of opening a browser. |
--store-only | Serve only the store files, skipping the bundled UI — useful when hosting your own front end. |
--frontend-dir | Serve a custom Explorer build from this directory. |
The command exposes read-only GET/HEAD access to the store's files. To modify a
store, use refget store add, pull, and alias.
Serving on a shared server
Section titled “Serving on a shared server”To let others on your network reach a store hosted on a cluster login node, bind a public interface and skip opening a local browser:
refget store explore /cvmfs/data.example.org/refget-store --host 0.0.0.0 --no-browserThen share the printed Explorer URL. See What is RefgetStore? for background on the store format and its local/remote symmetry.