Skip to content

RefgetStore Tutorial

This tutorial shows how to use RefgetStore for storing and retrieving sequences. For background on what RefgetStore is and why you’d use it, see What is RefgetStore? This tutorial assumes you can already install the refget package, and know the basics of refget digests.

Learning objectives

  • Create and load a RefgetStore from FASTA files
  • Retrieve sequences by digest or by name
  • Extract subsequences and regions from BED files
  • Export sequences to FASTA format
  • Connect to a remote RefgetStore with local caching

1. Creating a local RefgetStore from FASTA

Section titled “1. Creating a local RefgetStore from FASTA”

Let’s start by creating a RefgetStore from some FASTA files. The store computes sequence digests and indexes everything for fast retrieval.

RefgetStore offers two storage modes:

  • in_memory(): Loads all sequences into RAM. Best for maximum lookup speed when you have sufficient memory (rare, for specific use cases).

  • on_disk(path): Lazy-loads sequences from disk as they’re accessed. Best for large genomes or when you only need a subset of sequences, or if you’re wanting to persist sequences to disk for later use (most common).

We’ll create both types so you can see how they work.

import os
import tempfile
from refget.store import RefgetStore, digest_fasta

Just grab some dummy data for this tutorial.

temp_dir = tempfile.mkdtemp(prefix="refget_tutorial_")
# First FASTA file
fasta1_path = os.path.join(temp_dir, "genome1.fa")
with open(fasta1_path, "w") as f:
f.write(">chr1\nATGCATGCATGCAGTCGTAGCNNNATGCATGC\n>chr2\nGGGGAAAATTTTCCCC\n")
# Second FASTA file
fasta2_path = os.path.join(temp_dir, "genome2.fa")
with open(fasta2_path, "w") as f:
f.write(">chrX\nACGTACGTACGTACGTACGTACGTACGT\n>chrY\nTTTTAAAACCCCGGGG\n")
print(f"Created: {fasta1_path}")
print(f"Created: {fasta2_path}")
Created: /tmp/refget_tutorial_nk_w1nqa/genome1.fa
Created: /tmp/refget_tutorial_nk_w1nqa/genome2.fa
store = RefgetStore.in_memory()
store.add_sequence_collection_from_fasta(fasta1_path)
store.add_sequence_collection_from_fasta(fasta2_path)
print(f"Created in-memory store with {len(store)} sequences")
Processing /tmp/refget_tutorial_nk_w1nqa/genome1.fa...
Added NikmJ6xnuvO741NgL-zszh5_p4DsD3nV (2 seqs) in 0.0s [0.0s digest + 0.0s encode]
Processing /tmp/refget_tutorial_nk_w1nqa/genome2.fa...
Added zmVRc4oI2ny1UgSMdSdjj-FG-TkaUtvh (2 seqs) in 0.0s [0.0s digest + 0.0s encode]
Created in-memory store with 4 sequences

For larger datasets, you’ll want to persist sequences to disk. This creates a directory structure that can be loaded later or even served remotely. See RefgetStore file format for details on the directory structure.

# Create a persistent store on disk
store_path = os.path.join(temp_dir, "my_refget_store")
disk_store = RefgetStore.on_disk(store_path)
disk_store.add_sequence_collection_from_fasta(fasta1_path)
disk_store.add_sequence_collection_from_fasta(fasta2_path)
print(f"Store saved to: {store_path}")
Processing /tmp/refget_tutorial_nk_w1nqa/genome1.fa...
Added NikmJ6xnuvO741NgL-zszh5_p4DsD3nV (2 seqs) in 0.0s [0.0s digest + 0.0s encode]
Processing /tmp/refget_tutorial_nk_w1nqa/genome2.fa...
Added zmVRc4oI2ny1UgSMdSdjj-FG-TkaUtvh (2 seqs) in 0.0s [0.0s digest + 0.0s encode]
Store saved to: /tmp/refget_tutorial_nk_w1nqa/my_refget_store

You can control persistence dynamically. This is useful if you want to start in-memory for speed, then persist results when you’re done:

# Start in-memory, then persist to disk
persist_store = RefgetStore.in_memory()
persist_store.add_sequence_collection_from_fasta(fasta1_path)
# Enable persistence - flushes existing data to disk
persist_path = os.path.join(temp_dir, "persisted_store")
persist_store.enable_persistence(persist_path)
print(f"Enabled persistence to: {persist_path}")
# Later you can also disable persistence (keep in memory only)
persist_store.disable_persistence()
print("Persistence disabled - new sequences stay in memory only")
Processing /tmp/refget_tutorial_nk_w1nqa/genome1.fa...
Added NikmJ6xnuvO741NgL-zszh5_p4DsD3nV (2 seqs) in 0.0s [0.0s digest + 0.0s encode]
Enabled persistence to: /tmp/refget_tutorial_nk_w1nqa/persisted_store
Persistence disabled - new sequences stay in memory only

Once you’ve created a store on disk, you can reload it later:

# Load the store we just created
loaded_store = RefgetStore.open_local(store_path)
print(f"Loaded store: {loaded_store.stats()}")
Loaded store: {'n_collections_loaded': '0', 'storage_mode': 'Encoded', 'n_sequences_loaded': '0', 'total_disk_size': '2209', 'n_sequences': '4', 'n_collections': '2'}

Note: n_sequences_loaded: 0 means no sequence data has been loaded into memory yet, while n_sequences shows the total number of sequences in the store on disk, available for loading.

By default, RefgetStore prints progress messages when adding sequences. To suppress this output (useful in scripts), use set_quiet():

quiet_store = RefgetStore.in_memory()
quiet_store.set_quiet(True)
resp = quiet_store.add_sequence_collection_from_fasta(fasta1_path) # No output
print(f"Quiet mode enabled: {quiet_store.quiet}")
print(f"Store has {len(quiet_store)} sequences")
Quiet mode enabled: True
Store has 2 sequences

A common task is exporting sequences from your store back to FASTA format. You can export full sequences by their digests or by collection.

First, let’s get the sequence metadata and collection digest we’ll use for exports:

# List sequences in our store
records = list(store.list_sequences())
for m in records:
print(f"{m.name}: {m.length} bp, sha512t24u={m.sha512t24u}")
# Get the collection digest for genome1
collection = digest_fasta(fasta1_path)
collection_digest = collection.digest
print(f"\nCollection digest: {collection_digest}")
chr2: 16 bp, sha512t24u=8zS0M3VBpV7-TNdB7RjfpMbC8hrz6SbH
chr1: 32 bp, sha512t24u=EjrJJS1FmLaytz_EHgNvVZ8owSU7kbNb
chrX: 28 bp, sha512t24u=RCjXT2ppbKhHY6S2106R43I6-QpTqgwT
chrY: 16 bp, sha512t24u=xNe1wHi4Bzi0uC62_W69LX1JLrPbLCDH
Collection digest: NikmJ6xnuvO741NgL-zszh5_p4DsD3nV
# Get digests of sequences to export (records is a list of SequenceMetadata)
digests = [m.sha512t24u for m in records[:2]]
output_path = os.path.join(temp_dir, "exported.fa")
store.export_fasta_by_digests(digests, output_path, line_width=60)
print("Exported FASTA:")
with open(output_path) as f:
print(f.read())
Exported FASTA:
>chr2
GGGGAAAATTTTCCCC
>chr1
ATGCATGCATGCAGTCGTAGCNNNATGCATGC

Export by collection (with optional name filtering)

Section titled “Export by collection (with optional name filtering)”

You can export all sequences from a collection, or filter to specific chromosomes:

# Export all sequences from a collection
all_output = os.path.join(temp_dir, "all_seqs.fa")
store.export_fasta(collection_digest, all_output, None, None) # None = all sequences, default line width
# Export only specific sequences by name
subset_output = os.path.join(temp_dir, "subset.fa")
store.export_fasta(collection_digest, subset_output, ["chr1"], None)
print("All sequences:")
with open(all_output) as f:
print(f.read())
print("Subset (chr1 only):")
with open(subset_output) as f:
print(f.read())
All sequences:
>chr1
ATGCATGCATGCAGTCGTAGCNNNATGCATGC
>chr2
GGGGAAAATTTTCCCC
Subset (chr1 only):
>chr1
ATGCATGCATGCAGTCGTAGCNNNATGCATGC

For interactive analysis in Python, you can retrieve sequences and subsequences directly into memory. RefgetStore treats sequences as the primary unit of storage - each unique sequence is stored once regardless of how many collections contain it.

If you know a sequence’s refget digest, you can retrieve it directly:

# Get the first sequence's digest
first_digest = records[0].sha512t24u
# Retrieve by digest
record = store.get_sequence(first_digest)
if record:
print(f"Name: {record.metadata.name}")
print(f"Length: {record.metadata.length}")
Name: chr2
Length: 16

You can extract specific regions from a sequence:

# Get a subsequence (0-indexed, half-open interval)
subsequence = store.get_substring(first_digest, 0, 10)
print(f"First 10 bases: {subsequence}")
subsequence = store.get_substring(first_digest, 5, 15)
print(f"Bases 5-15: {subsequence}")
First 10 bases: GGGGAAAATT
Bases 5-15: AAATTTTCCC

Beyond individual sequences, RefgetStore tracks collections, which are groups of sequences that belong together (like a genome assembly). You can browse collection metadata without loading the full collection:

# List all collections in the store
collections = list(store.list_collections())
for meta in collections:
print(f"Collection {meta.digest[:20]}...: {meta.n_sequences} sequences")
# Get the first collection's digest for subsequent examples
first_collection_digest = collections[0].digest
# Get metadata for a specific collection
collection_meta = store.get_collection_metadata(first_collection_digest)
if collection_meta:
print(f"\nCollection details:")
print(f" Sequences: {collection_meta.n_sequences}")
print(f" Names digest: {collection_meta.names_digest}")
# Check if a collection is fully loaded in memory
print(f"\nCollection loaded: {store.is_collection_loaded(first_collection_digest)}")
Collection NikmJ6xnuvO741NgL-zs...: 2 sequences
Collection zmVRc4oI2ny1UgSMdSdj...: 2 sequences
Collection details:
Sequences: 2
Names digest: XEsH8IMZ09CBX17iXEWRagH50VGfARLo
Collection loaded: True

Since we have two genome collections loaded, we can compare them to see what they share:

second_collection_digest = collections[1].digest
comparison = store.compare(first_collection_digest, second_collection_digest)
print(f"Shared attributes: {comparison['attributes']['a_and_b']}")
print(f"A-only attributes: {comparison['attributes']['a_only']}")
print(f"B-only attributes: {comparison['attributes']['b_only']}")
Shared attributes: ['lengths', 'name_length_pairs', 'names', 'sequences', 'sorted_name_length_pairs', 'sorted_sequences']
A-only attributes: []
B-only attributes: []

RefgetStore supports additional GA4GH Sequence Collections spec operations, including level 1/2 retrieval, attribute lookups, and ancillary digests. See Seqcol Operations for details.

You can also assign human-readable aliases to collections (like “hg38” or “GRCh38.p14”) organized by namespace. See Working with Aliases for details.

Once you have a collection digest, you can load the full collection and iterate through its sequences:

# Get the full collection (not just metadata)
collection = store.get_collection(first_collection_digest)
print(f"Collection digest: {collection.digest}")
print(f"Number of sequences: {len(collection.sequences)}")
# Iterate through sequences in this collection
print("\nSequences in collection:")
for seq in collection.sequences:
first_10 = store.get_substring(seq.metadata.sha512t24u, 0, 10)
print(f" {seq.metadata.name}: {seq.metadata.length} bp, starts with {first_10}...")
Collection digest: NikmJ6xnuvO741NgL-zszh5_p4DsD3nV
Number of sequences: 2
Sequences in collection:
chr1: 32 bp, starts with ATGCATGCAT...
chr2: 16 bp, starts with GGGGAAAATT...

Often you’ll want to look up a sequence by its name within a collection (like “chr1” in a genome assembly):

# Lookup chr1 in the first collection
record = store.get_sequence_by_name(first_collection_digest, "chr1")
if record:
first_10 = store.get_substring(record.metadata.sha512t24u, 0, 10)
print(f"Found: {record.metadata.name}")
print(f"Length: {record.metadata.length} bp")
print(f"Digest: {record.metadata.sha512t24u}")
print(f"Starts with: {first_10}...")
Found: chr1
Length: 32 bp
Digest: EjrJJS1FmLaytz_EHgNvVZ8owSU7kbNb
Starts with: ATGCATGCAT...

For more flexible naming, RefgetStore also supports sequence aliases — human-readable names organized by namespace (e.g., “ucsc/chr1”, “ncbi/NC_000001.11”) that map to sequence digests. See Working with Aliases for details.

For bulk extraction of genomic regions, RefgetStore can read coordinates from a BED file. This is much faster than extracting regions one at a time.

# Create a BED file with regions
bed_path = os.path.join(temp_dir, "regions.bed")
bed_content = """chr1\t0\t10
chr1\t5\t20
chr2\t0\t8
"""
with open(bed_path, "w") as f:
f.write(bed_content)
# Extract regions (using collection_digest from Section 2)
sequences = store.substrings_from_regions(collection_digest, bed_path)
for seq in sequences:
print(f"{seq.chrom_name}:{seq.start}-{seq.end}: {seq.sequence}")
chr1:0-10: ATGCATGCAT
chr1:5-20: TGCATGCAGTCGTAG
chr2:0-8: GGGGAAAA

You can also write the extracted regions directly to a FASTA file:

output_fasta = os.path.join(temp_dir, "regions.fa")
store.export_fasta_from_regions(collection_digest, bed_path, output_fasta)
print(f"Exported to: {output_fasta}")
with open(output_fasta) as f:
print(f.read())
Exported to: /tmp/refget_tutorial_nk_w1nqa/regions.fa
>chr1 32 dna3bit EjrJJS1FmLaytz_EHgNvVZ8owSU7kbNb f64c9fb6ad2f6baad56e5a59ee07be63
ATGCATGCATTGCATGCAGTCGTAG
>chr2 16 dna2bit 8zS0M3VBpV7-TNdB7RjfpMbC8hrz6SbH 2640016f34792dc6302231ed4d027110
GGGGAAAA

So far we’ve been working with local data. But what if you want to access sequences from a public repository? RefgetStore can connect to remote stores hosted on S3, HTTP, or any file server.

The key insight is that you can use a local store as a cache for remote data. Sequences are downloaded on-demand and cached locally for future access. Let’s connect to a remote pangenome store:

# Remote store URL (Human Pangenome Reference - haplotype-resolved assemblies)
REMOTE_URL = "https://refgenie.s3.us-east-1.amazonaws.com/pangenome_refget_store"
# Create a fresh cache directory for the remote store
remote_cache_path = os.path.join(temp_dir, "remote_cache")
remote_store = RefgetStore.open_remote(
cache_path=remote_cache_path,
remote_url=REMOTE_URL
)
# The remote index is fetched automatically - stats show all remote collections!
print(f"Remote store stats: {remote_store.stats()}")
# List available collections from the remote store
remote_collections = list(remote_store.list_collections())
print(f"\nRemote collections available: {len(remote_collections)}")
for c in remote_collections[:3]:
print(f" {c.digest}: {c.n_sequences} sequences")
Remote store stats: {'n_collections_loaded': '0', 'total_disk_size': '6651362', 'n_sequences': '37603', 'storage_mode': 'Encoded', 'n_sequences_loaded': '0', 'n_collections': '96'}
Remote collections available: 96
-Sfh5nx4f7dSrGDdfmz7xA0nsN5jh-mN: 566 sequences
-Z38q8izmrexleQATeOvcp0sZo6aSXMa: 436 sequences
0qveCdMlbF_kYn6XWb7YBy-FtRZ6gSAL: 481 sequences

The remote index is fetched automatically when opening the store, so n_collections and n_sequences show the full remote catalog. However, no sequence data has been downloaded yet (n_sequences_loaded: 0).

Let’s retrieve a sequence - this will download it and cache it locally:

# Pick a collection from the remote store
EXAMPLE_COLLECTION = remote_collections[0].digest
# Get the collection to see its sequences
example_coll = remote_store.get_collection(EXAMPLE_COLLECTION)
EXAMPLE_SEQ_NAME = example_coll.sequences[0].metadata.name
print(f"Collection: {EXAMPLE_COLLECTION}")
print(f"Sequence: {EXAMPLE_SEQ_NAME}")
# Retrieve the sequence (this downloads and caches it)
record = remote_store.get_sequence_by_name(EXAMPLE_COLLECTION, EXAMPLE_SEQ_NAME)
if record:
first_10 = remote_store.get_substring(record.metadata.sha512t24u, 0, 10)
print(f"\nDownloaded: {record.metadata.name}")
print(f"Length: {record.metadata.length:,} bp")
print(f"Starts with: {first_10}...")
# The sequence is now cached locally
print(f"\nRemote store stats: {remote_store.stats()}")
Downloading collection -Sfh5nx4f7dSrGDdfmz7xA0nsN5jh-mN...
Downloading sequence tikrfFado1spIG9SfD_E0SN4WYGCQjbi...
Collection: -Sfh5nx4f7dSrGDdfmz7xA0nsN5jh-mN
Sequence: JAHEOS010000074.1
Downloaded: JAHEOS010000074.1
Length: 6,063,115 bp
Starts with: TATATATGTA...
Remote store stats: {'n_sequences_loaded': '1', 'n_collections_loaded': '1', 'storage_mode': 'Encoded', 'total_disk_size': '8267385', 'n_collections': '96', 'n_sequences': '37603'}

Notice how n_sequences_loaded increased - the sequence data is now cached locally. Subsequent requests for this sequence will be served from disk without network access.

Let’s extract some regions from the remote pangenome using a BED file. This demonstrates how you can work with remote data just like local data:

# Create a BED file with regions from the remote collection
remote_bed_path = os.path.join(temp_dir, "remote_regions.bed")
with open(remote_bed_path, "w") as f:
# Using the sequence we just downloaded
f.write(f"{EXAMPLE_SEQ_NAME}\t1000\t1050\n")
f.write(f"{EXAMPLE_SEQ_NAME}\t5000\t5100\n")
# Extract regions - this uses the cached sequence, no re-download needed
remote_regions = remote_store.substrings_from_regions(EXAMPLE_COLLECTION, remote_bed_path)
for seq in remote_regions:
print(f"{seq.chrom_name} {seq.start}-{seq.end}: {seq.sequence[:40]}...")
# Export to FASTA
remote_regions_fasta = os.path.join(temp_dir, "remote_regions.fa")
remote_store.export_fasta_from_regions(EXAMPLE_COLLECTION, remote_bed_path, remote_regions_fasta)
print(f"\nExported to {remote_regions_fasta}")
JAHEOS010000074.1 1000-1050: CCTAAAGTCACAAAGCTGAGACTCAAACCTAGGTCTCAGG...
JAHEOS010000074.1 5000-5100: CCATCATTGTGGAGAAATTTTTACTGAGATATAATGGACA...
Exported to /tmp/refget_tutorial_nk_w1nqa/remote_regions.fa

Everything we’ve done in Python can also be done from the command line. Here are the equivalent CLI commands for common operations.

Check the store stats:

Terminal window
refget store stats --path /path/to/store
import subprocess
def run_cli(args):
"""Run a CLI command and print the command + output."""
cmd = " ".join(args)
print(f"$ {cmd}")
result = subprocess.run(args, capture_output=True, text=True)
print(result.stdout)
run_cli(["refget", "store", "stats", "--path", store_path])
$ refget store stats --path /tmp/refget_tutorial_nk_w1nqa/my_refget_store
{
"n_sequences_loaded": "0",
"n_collections": "2",
"n_collections_loaded": "0",
"n_sequences": "4",
"storage_mode": "Encoded",
"total_disk_size": "2209",
"collections": 2
}

Retrieve a subsequence by digest:

Terminal window
refget store seq <digest> --path /path/to/store --start 0 --end 10
run_cli(["refget", "store", "seq", first_digest, "--path", store_path, "--start", "0", "--end", "10"])
$ refget store seq 8zS0M3VBpV7-TNdB7RjfpMbC8hrz6SbH --path /tmp/refget_tutorial_nk_w1nqa/my_refget_store --start 0 --end 10
GGGGAAAATT

For the full list of CLI commands and options, see the CLI reference.

Summary

  • RefgetStore provides content-addressable storage for sequences - identical sequences are automatically deduplicated, even across different genome assemblies.
  • Choose in-memory mode for maximum speed, or on-disk mode for large datasets and persistence. You can switch between them dynamically.
  • Every sequence and collection has a refget digest, enabling universal identification and retrieval by either digest or collection + name.
  • Remote stores work transparently with local caching - sequences are downloaded on-demand and cached locally for future access.
  • BED file extraction enables efficient batch retrieval of genomic regions, much faster than extracting regions one at a time.
  • The same operations are available via Python API or command-line interface.

This tutorial covered the core RefgetStore operations. For more advanced features, see:

  • Seqcol Operations — Compare collections, retrieve level 1/2 representations, search by attribute digests, and work with ancillary digests.
  • Working with Aliases — Assign human-readable names to sequences and collections, organized by namespace (e.g., “ucsc/chr1”, “gencode/GRCh38.p14”).
  • FHR Metadata Headers — Attach FAIR Headers Reference genome (FHR) metadata to collections, describing species, version, authors, and other assembly-level context.
# Cleanup
import shutil
shutil.rmtree(temp_dir)